Structural studies on DNA G-quadruplexes
Saved in:
| Title: | Structural studies on DNA G-quadruplexes |
|---|---|
| Authors: | Burge, Sarah Wallace |
| Summary: | Guanine-rich lengths of DNA are capable of self-assembly into higher order structures known as G-quadruplexes. Guanine rich DNA sequences from a range of biologically relevant regions in the human genome, most notably telomeric DNA, have been observed to form such structures. To date a wide variety of quadruplex structures have been experimentally determined. This thesis is primarily concerned with the characterisation of a G-rich region of DNA from the c-kit oncogene promoter region. This work investigates the ability of this sequence, d(AGGGAGGGCGCTGGGAGGAGGG) (known as c-kit I), to form quadruplex structures using a range of biophysical techniques, principally nuclear magnetic resonance, UV melting studies and CD spectroscopy. The structural and thermodynamic properties of a quadruplex forming from this sequence are comprehensively examined. G-quadruplexes are known to be sensitive to small mutations in their loop regions and a series of three mutated sequences was created with the aim of elucidating the effects of mutations on the quadruplex forming ability of this region of G-rich DNA. The effect of each mutation was examined using the biophysical methods outlined above. Molecular dynamics simulations have also been performed to investigate three different quadruplex topologies that this sequence may adopt in the solution phase. Free-energy calculations were undertaken to investigate the relative stabilities of the possible folds. The molecular dynamics simulations also provide an insight into the behaviour of the loop regions for a range of possible loop topologies. Ligand interaction with a model of the parallel c-kit I quadruplex was also studied by molecular dynamics in order to provide a structural rationale for ligand binding. A range of acridine-based ligands were studied and the model was validated by comparison with experimentally observed binding affinities. Modelling studies were also undertaken to examine the relative behaviour of two human telomeric quadruplex structures. Results show that the c-kit 1 sequence is capable of forming a single quadruplex species with a novel parallel motif. The sequence is highly sensitive to mutation; modified sequences do not show any quadruplex forming ability. Modelling studies on the human telomeric quadruplex folds reveal that base pairing contributes significantly to the overall stability of the 3+1 fold. The availability of these bases to participate in pairing interactions in vivo may determine the viability of the mixed fold in a cellular environment. |
| URL: | https://ethos.bl.uk/OrderDetails.do?uin=uk.bl.ethos.435434 |
| Database: | OpenDissertations |
Be the first to leave a comment!